Hello all, this might be better suited for a bioinformatics forum, but I thought I'd try my luck here as well.
I have several tabular text files of DNA sequence reads that appear as such:
File_1.txt
>H01BA45XW GATTACAGATTCGACATCCAACTGAGGCATT
>H02BG78WR CCTTACAGACTGGGCATGAATATTGCATACC
>H04AR88VN CCTTACAGACTAGGACTACTACGTAGCATAC
>H03GH43TY GATTACAGCCTTTTAGACGCAGCTGAGGC
Every native sequence has a known artificial "adapter" before and after it. For this example let's say the adapters are those which I placed in lower case below (the file does not actually appear as such, this is only to illustrate my point):
>H01BA45XW gattacagATTCGACATCCAActgaggcatt
>H02BG78WR ccttacagactGGGCATGAATATTgcataccg
>H04AR88VN ccttacagactAGGACTACTACGTAgcatac
>H03GH43TY gattacagCCTTTTAGACGCAGctgaggc
Now, as you can see, the adapters aren't uniform as they may vary in sequence and in length, or even have random small mismatches and gaps (products of many technical factors). What I would ideally like to do is retrieve the "cores" of those sequence reads. What I have done is use an alignment program (megablast) to ascertain the coordinates in each sequence string where those adapters lay and have them in a separate tabular text file:
File_2.txt
>H01BA45XW 1,8 22,31
>H02BG78WR 1,11 25,32
>H04AR88VN 1,11 26,31
>H03GH43TY 1,8 23,29
The problem is that I don't know if there are any combinations of scripts I can use to just remove/delete those adapters based on variable coordinates for hundreds of thousands of sequences to preserve the cores, which are what I'm really interested in analyzing.
There are many adapter stripping programs out there (bioperl, seqtrim, etc.), but all had failed in one way or another (grabbed too much adapter and cut into the native cores, didn't grab enough adapter and left overhanging chunks, or simply failed to recognize them altogether because of mismatches). The alignment program gave me powerful resolution as far as identification of adapters, but has no option to strip them off. I feel like this should be a not too difficult text editing task for a shell or perl script:
A) given a unique ID on each line in column 1 of file 2, find the line with that same ID in column 1 of file 1,
B) then use coordinates in column 3 of file 2 to remove those same coordinates in the string in column 2 of file 1,
C) then use coordinates in column 2 of file 2 to remove those same coordinates in the string in column 2 of file 1,
D) move on to the next line in file 2 and repeat until completion
As an alternative, I can use those coordinates as well as sequence lengths to also get the coordinates of the cores I'd like to keep, but same problem, I'm not sure how I'd go about asking to have just those variable substrings printed along with their corresponding IDs. I can kind of get this process to work in Excel/Open Office, but for files of 20mb+ in size, there's no way it could handle the work load.
I'm using Ubuntu 11.10, 32 bit
Any guidance/suggestions/etc. would be greatly appreciated! :wall: